No association between N7-methyldeoxyguanosine and 8-oxodeoxyguanosine levels in human lymphocyte DNA

To examine associations between two different classes of DNA damage that can occur through endogenous processes or exogenous exposures such as smoking, N7-methyldeoxyguanosine (N7-MedG) and 8-oxodeoxyguanosine (8-oxodG) levels were measured in lymphocyte DNA from 22 bronchoscopy patients. 8-OxodG and N7-MedG was detected in 100% and 91% of samples, respectively with 8-oxodG levels being approx 20 times higher (mean 8.39 ± 3.57 8-oxodG/10⁶dG versus 0.41 ± 0.33 N7-MedG/10⁶ dG) which provides an indication of the relative importance of the agents that induce oxidative DNA damage or alkylation damage. The sources of these genotoxic lesions remain to be established but N7-MedG and 8-oxodG levels were not correlated (r² < 0.01) suggesting that there is no association between alkylating agent and reactive oxygen species exposure, their metabolism and/or the DNA repair processes that can remove this DNA damage.     

The essential fatty acid status in phenylketonuria patients under treatment

Phenylketonuric patients are on a special diet that lacks certain essential fatty acids. This study evaluates the essential fatty acid status of a group of phenylketonuric patients in the Netherlands undergoing dietary treatment. To this end, the essential fatty acid status of nine phenylketonuria patients was studied. On the basis of age and gender, two control subjects were selected for each patient. The essential fatty acid composition of duplicate food portions and the essential fatty acid status of plasma and erythrocytes were analyzed. Phenylketonuria subjects had a different essential fatty acid profile from their peers, especially concerning the n-3 fatty acids. N-6 and n-3 fatty long-chain polyenes were hardly consumed by phenylketonuria subjects, in contrast to the control subjects. Linoleic acid, on the other hand, was consumed in significantly higher amounts by phenylketonuria subjects and made up about 40% of their daily fat consumption. The essential fatty acid consumption pattern of the phenylketonuria subjects is mirrored by the essential fatty acid concentrations in blood. The essential fatty acid status of the phenylketonuric diet should be improved in order to prevent deficiency in n-3 fatty acids.     

The genetic control of natural killer cell activity and its association with in vivo resistance against a moloney lymphoma isograft

Spleens of normal young mice of certain strains contain lymphocytes that can kill strain A-derived YAC-1 lymphoma cells in a⁵¹Cr release cytotoxic assay in vitro. We have previously classified mouse genotypes as high or low reactors, according to their responses in this test. In vivo resistance to small numbers of YAC ascites lymphoma cells is correlated with in vitro cytolytic activity. In vitro and in vivo tests were carried out on the same individual (A x C57BL)F₁ x A backcross mice. Natural in vitro killer cell activity appeared to be under polygenic control, including a strong H-2-linked factor. No linkage was found with five different isozyme loci, with theIg-l locus or with C5 serum activity. Also in vivo resistance showed strong linkage with theH-2 complex. In (A x CBA)F₁ x A backcross mice, a weak linkage was found with the coat color locusC. There was a correlation between in vitro killer activity and in vivo resistance in the same backcross mice. In vivo resistance was particularly strong in mice that combined theH-2 ^b -linked resistance factor with a high cytolytic activity in vitro.     

Human gene mapping using an X/autosome translocation.

Human fibroblasts containing a translocation between the X chromosome and chromosome 15 were fused with the 6-thioguanine-resistant mouse cell line, IR. Resulting hybrids, selected in HAT medium, retained the X/15 chromosome. Hybrids which were counterselected in 6-thioguanine lost this chromosome. The X-linked markers glucose-6-phosphate dehydrogenase (G6PD), phosphoglycerate kinase (PGK), and hypoxanthine phosphoribosyl transferase (HPRT), and the non-X-linked markers pyruvate kinase (PKM2) mannose phosphate isomerase (MPI), N-acetyl hexosaminidase A (HEXA) and beta2-microglubulin (beta2-m) all segregated in concordance with the X/15 translocation chromosome. The latter markers have been assigned to chromosome 15. Selection against the X/15 chromosome was done using antihuman beta2-m serum. Electrophoretic and immunochemical analyses of the N-acetyl hexosaminidases A and B in these hybrids were performed.     

Elevated N3-methylpurine-DNA glycosylase DNA repair activity is associated with lung cancer

Tobacco smoke contains a range of chemical agents that can alkylate DNA. DNA repair proteins such as N3-methylpurine-DNA glycosylase (MPG) provide protection against cell killing and mutagenicity by removing lesions such as N7-methylguanine and N3-methyladenine. However, high levels of MPG activity in transfected mammalian cells in vitro have also been associated with increased genotoxicity. The aim of this study was to examine to what extent inter-individual differences in MPG activity modify susceptibility to lung cancer. Incident cases of lung cancer (n=51) and cancer free controls (n=88) were recruited from a hospital bronchoscopy unit. Repair activity was determined in a nuclear extract of peripheral blood mononuclear cells, using a [(32)P]-based oligonucleotide cleavage assay (MPG substrate 5'-CCGCT?AGCGGGTACCGAGCTCGAAT; ?A=ethenoadenine). MPG activity was not related to sex or smoking status but was significantly higher in cases compared to controls (4.21±1.67fmol/μg DNA/h vs 3.47±1.35fmol/μg DNA/h, p=0.005). After adjustment for age, sex, presence of chronic respiratory disease and smoking duration, patients in the highest tertile of MPG activity had a three fold increased probability of lung cancer (OR 3.00, 95% CI 1.16-7.75) when compared to those patients in the lowest tertile. These results suggest that elevated MPG activity is associated with lung cancer, possibly by creating an imbalance in the base excision repair pathway.     

Bone formation rather than inflammation reflects Ankylosing Spondylitis activity on PET-CT: a pilot study

Introduction

Positron Emission Tomography - Computer Tomography (PET-CT) is an interesting imaging technique to visualize Ankylosing Spondylitis (AS) activity using specific PET tracers. Previous studies have shown that the PET tracers [¹⁸F]FDG and [¹¹C](R)PK11195 can target inflammation (synovitis) in rheumatoid arthritis (RA) and may therefore be useful in AS. Another interesting tracer for AS is [¹⁸F]Fluoride, which targets bone formation. In a pilot setting, the potential of PET-CT in imaging AS activity was tested using different tracers, with Magnetic Resonance Imaging (MRI) and conventional radiographs as reference.

Methods

In a stepwise approach different PET tracers were investigated. First, whole body [¹⁸F]FDG and [¹¹C](R)PK11195 PET-CT scans were obtained of ten AS patients fulfilling the modified New York criteria. According to the BASDAI five of these patients had low and five had high disease activity. Secondly, an extra PET-CT scan using [¹⁸F]Fluoride was made of two additional AS patients with high disease activity. MRI scans of the total spine and sacroiliac joints were performed, and conventional radiographs of the total spine and sacroiliac joints were available for all patients. Scans and radiographs were visually scored by two observers blinded for clinical data.

Results

No increased [¹⁸F]FDG and [¹¹C](R)PK11195 uptake was noticed on PET-CT scans of the first 10 patients. In contrast, MRI demonstrated a total of five bone edema lesions in three out of 10 patients. In the two additional AS patients scanned with [¹⁸F]Fluoride PET-CT, [¹⁸F]Fluoride depicted 17 regions with increased uptake in both vertebral column and sacroiliac joints. In contrast, [¹⁸F]FDG depicted only three lesions, with an uptake of five times lower compared to [¹⁸F]Fluoride, and again no [¹¹C](R)PK11195 positive lesions were found. In these two patients, MRI detected nine lesions and six out of nine matched with the anatomical position of [¹⁸F]Fluoride uptake. Conventional radiographs showed structural bony changes in 11 out of 17 [¹⁸F]Fluoride PET positive lesions.

Conclusions

Our PET-CT data suggest that AS activity is reflected by bone activity (formation) rather than inflammation. The results also show the potential value of PET-CT for imaging AS activity using the bone tracer [¹⁸F]Fluoride. In contrast to active RA, inflammation tracers [¹⁸F]FDG and [¹¹C](R)PK11195 appeared to be less useful for AS imaging.     

Association of metabolic gene polymorphisms with alcohol consumption in controls

The objectives were to study the association between metabolic genes involved in alcohol metabolism (CYP2E1 RsaI, CYP2E1 DraI, ADH1C, NQO1) and alcohol consumption in a large sample of healthy controls. Healthy subjects were selected from the International Collaborative Study on Genetic Susceptibility to Environmental Carcinogens (GSEC). Subjects with information on both alcohol consumption and at least one of the studied polymorphisms were included in the analysis (n=2224). Information on the amount of alcohol consumption was available for a subset of subjects (n=844). None of the studied genes was significantly associated with drinking habits. A significant heterogeneity with age was observed when studying the association between CYP2E1 RsaI and alcohol drinking. CYP2E1 RsaI polymorphism was significantly associated with being a never drinker at older ages (odds ratio [OR] 2.4, 95% confidence interval [CI] 1.2-4.8; at ages above 68 years), while the association was reversed at ages below 47 years (OR 0.5, 95% CI 0.2-1.4). For subjects with detailed information on alcohol intake, no association between alcohol quantity and polymorphisms in metabolic genes was observed; subjects carrying the NQO1 polymorphism tended to drink more than subjects carrying the wild-type alleles. Therefore, no significant association between CYP2E1 RsaI, CYP2E1 DraI, ADH1C, NQO1 polymorphisms and alcohol consumption was observed in healthy controls.     

Polypeptide-metal cluster connectivities in Cd(II) GAL4

Two-dimensional 1H-113Cd correlation NMR spectra have been used to determine the polypeptide/metal cluster connectivities in Cd(II) GAL4. The results show that the protein contains a two metal ion cluster where Cys-11 and Cys-28 are the bridging ligands.